Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14523C5
Clone ID IST14523C5
Vector VICTR74
Project tigm

Sequence tag IST14523C5HMR1
Sequence
GTGCAGCTGTGGGAGAAAGCCAGAGACATTANATCCCTGGAGCTGGAGTTACAGGGAGCTGTGAGCAGATGTGGATGCTA
GGAGTCAAGCTTANGTCCTCTGGAANAACAGCCTGTGTTCTCAAGTACTGAGCCATCTCTCTGGTTCCCANATTTTTTTT
TTTTTTNAATTTTN
Sequence Type genomic DNA
Unitrap ID UNI16210

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 74795938..74796110 161
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024069 (Slc30a6) NM_144798 solute carrier family 30 (zinc transporter), member 6 Gene [Source:MGI Symbol;Acc:MGI:2386741]


Sequence tag IST14523C5BBF1
Sequence
CACCCACGTGCACATAACNNCACAATTTAAAAGAATACGGTGAATTCTTTTACAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 74795882..74795940 55
NO GENE  

 
Come back to gene ENSMUSG00000024069


For any suggestions or comments, please send an email to unitrap@crg.es