Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10954H5
Clone ID IST10954H5
Vector VICTR76
Project tigm

Sequence tag IST10954H5HMF1
Sequence
AACCTAGCCTGTAGATTATCATGGCTGCCCCTGAAAAGCAAAACAGTGACCCATAACTATGGCCTCAGAGAGCCTCGGCA
TCCACAAGCAAGAGTGGAGACAGTGGAGACAAGAGCTAGATGATGTTAATTGTCTGTGGCATAGTCNCN

Sequence Type genomic DNA
Unitrap ID UNI27157

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152594768..152594913 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007659 (Bcl2l1) NM_009743 BCL2-like 1 Gene [Source:MGI (curated);Acc:Bcl2l1-001]


Sequence tag IST10954H5BBF1
Sequence
AACCTAGCCTGTAGATTATCATGGCTGCCCCTGAAAAGCAAAACAGTGACCCATAACTATGGCCTCAGAGAGCCTCGGCA
TCCACAAGCAAGAGTGGAGACAGTGGAGACAAGAGCTAGATGATGTTAATTGTCTGTGGCATAGTCTCTCTCTCTCTCTC
TCTCTCTCTCTCTCTCTCTCTCTCTCTCNCTCNNTNTNTCN

Sequence Type genomic DNA
Unitrap ID UNI27157

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152594722..152594913 190
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007659 (Bcl2l1) NM_009743 BCL2-like 1 Gene [Source:MGI (curated);Acc:Bcl2l1-001]

 
Come back to gene ENSMUSG00000007659


For any suggestions or comments, please send an email to unitrap@crg.es