Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10140A1
Clone ID IST10140A1
Vector VICTR76
Project tigm

Sequence tag IST10140A1HMF1
Sequence
AAGTGTCCCGGTGTATCCTGCCAACTGAACGAACGTTTCTAGTCCTCCCACCACCCACTGCTCTCGCCAGGGGTCGCGGT
AAGGAAGCCCCGCCCTACTAGAACTTCCGGCTCCCAGGAACCGTCTGTCCTCAGCTCCAAGTGGGCGGTCCCCGAGCTTC
TGGCACCGCCCCGGAAGTGACGCCAGGACGTCCCTTCCATTTTGTGCANCGTCCGANCTGCTAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 82046293..82046516 220
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021134 (Sfrs5) NM_001079694 splicing factor, arginine/serine-rich 5 (SRp40, HRS) Gene [Source:MGI (curated);Acc:Sfrs5-009]


Sequence tag IST10140A1BBF1
Sequence
TAGTGATTTCAAGGAATTAGACTGGTGTGTGTAATCACTGAAGTGATTCCTGCTTTGTGGGTTGGGTTTTGAAGACAAGC
TTGTGAGGTAATGGCTACCCTTCTTGGTGGCACACACCCCTCGGCTTTTTTTTCACTTTAAGCATAGTGAAGCTTGNAAA
GAAAATCACACATAGAATAAAGCAAAGATACCAGGAGCTCANCATAGATGGTATCCCGTGTGCACAGTGAAAAGCATACC
ATCGAGCCGGTATATGCAGGATCT
Sequence Type genomic DNA
Unitrap ID UNI30536

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 81079928..81080190 259
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031684 (Slc10a7) NM_029736 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 Gene [Source:MGI Symbol;Acc:MGI:1924025]

 
Come back to gene ENSMUSG00000031684


For any suggestions or comments, please send an email to unitrap@crg.es