Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14175G3
Clone ID IST14175G3
Vector VICTR74
Project tigm

Sequence tag IST14175G3BBF1
Sequence
AAAGCTATCCCGACTCTTACTGACTGCACTCTGCGAGATTTATGAAGAGTTGAGAGACAACAAATCAGCCTTTACAGCAC
GCCATAATAATTTTTAAGTGATGCCAAACATGTTTCCTAAAAACCTACGTTTACAACACGTCTACTTACAAATGTTAACT
AAATTTGAATGACAGTTCCGCTTAAACTTCCAACCAACGCAATGGCAGGACGTCCCCTAAATGTTGTCATTCACAGCAGC
CAAAGGGCCACCTGTACACCTCTCTCCTTGAACAAAGCATACCTATTATTTTATACAAAAATCCACCTGAGTCAGCTTGC
CCATGCAAAGAGCCATCCAACCTGTGTCCCTGGAGGACAAAGAACAAACTGCACCATCAAATCTAGATGGGGAAAAAAGT
TCACTTCCTCTATAGGTACTTGGTCAGAAAGCATTTTCAAAACACATGANANTGTGANCNNAGAAATTAAAAGGCTAANA
CCTTANNACTGACAGTTCTACTCTTTACNTGTTTCATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 51952231..51952747 499
 
EST/CDNA Est Name
  CA325080.1 - CA324514.1 - BU057371.1 - BY732144.1 - CB525643.1 - BY723875.1 - BY739043.1 - CX729219.1 - BQ944618.1 - BY713412.1 - BG175148.1 - CV676263.1 - CN670874.1 - CN664847.1 - CK393019.1 - AI098520.1 - AI530156.1 - CA871103.1 - BM895069.1 - BM894894


Sequence tag IST14175G3HMR1
Sequence
CTTTGATTCTTAAATATAGTGTNACTTCTAACATTGCAAGGAAAAAGGACCCAGAAATTGATACAGAAAATGCTTCCAAA
TTCTAATGTGGTTGTTGATTTTAGTCC
Sequence Type genomic DNA
Unitrap ID UNI24253

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 51952129..51952234 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018417 (Myo1b) NM_010863 myosin IB Gene [Source:MGI (curated);Acc:Myo1b-002]


Sequence tag IST14175G3HMF1
Sequence
AAAGCTATCCCGACTCTTACTGACTGCACTCTGCGAGATTTATGAAGAGTTGAGAGACAACAAATCAGCCTTTACAGCAC
GCCATAATAATTTTTAAGTGATGCCAAACATGTTTCCTAAAAACCTACGTTTACAACACGTCTACTTACAAATGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 51952231..51952386 156
NO GENE  

 
Come back to gene ENSMUSG00000018417


For any suggestions or comments, please send an email to unitrap@crg.es