Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15068A6
Clone ID IST15068A6
Vector VICTR80
Project tigm

Sequence tag IST15068A6BBF1
Sequence
CGGTGGTGTACATGCATGTATGATCTCAACCTGGAGGATGGACAGTTCTGGGCCAGTCTGGGGGATGTAGAGTTCAAGGT
CAATAAGAACTATTATGAGATGTCTCAAAATATCCAGAAGTAACATTTACCTTCCCATAAGGGATGGCTGAGTTTATGGA
TAAGAACTCCGTAGGCACGGGGACAGATGAGAGAAGTCAGGCTGAGTTCAGTGAGCTCACACAGCTTTAGTGTACAGTGG
GTTGGCTCTGGAGCCAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 133213623..133213883 261
 
EST/CDNA Est Name
  AI563610.1


Sequence tag IST15068A6HMF2
Sequence
CATGCATGCAGGGACACGTACAGGCATGTGCACCCACGAACGTACATATAAGCACAAAGAATACCTTCATTAACACAGCT
ACTTAATTAGAATTAGAAGTAACATAGCCTTAGTACTGGGAAAGCTGATGCAGGAAAGACCCACATTCTAGGCTAGCTTA
GTTATACAGCAAGATTTAGGCTAACTGGTGGCTTCGGTGAGACATGTCTCAGCTACTTTCTGATCTCCCCAAAATTTGTT
TTGAATGCTCAAACTGAATTGGGTTGAACCTAATGCCAGATACATTTGAAGTAGTTGCTGTACCATTAAATTACATCACA
GCCACTGAACCTCATTTATATTAGCTTGTAATGTATGGAAATTTTAAAGANGAGGAGCTAGAGAGATTGCTCAGTGGTTG
AGAGCTCTTGCTGCCCATGGAGANGANCCCAGTTTGGTCCCCAGCACCCACATTGTGGCTCTNNNNCNTTTGTAACTCAG
TCCNNNNAAACCCAACN
Sequence Type genomic DNA
Unitrap ID UNI17235

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72842681..72843176 472
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034563 (Ccpg1) NM_028181 cell cycle progression 1 Gene [Source:MGI Symbol;Acc:MGI:1196419]

 
Come back to gene ENSMUSG00000034563


For any suggestions or comments, please send an email to unitrap@crg.es