Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10952D7
Clone ID IST10952D7
Vector VICTR76
Project tigm

Sequence tag IST10952D7BBF1
Sequence
AGTTCCAGGACAGCCAGGGCTACACAAAGAAACCCTGTCTCA
Sequence Type genomic DNA
Unitrap ID UNI2894 UNI16116 UNI31377 UNI35556 UNI35557 UNI35558

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 272910..272951 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 11012777..11012818 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 60884602..60884643 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3392751..3392792 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 11099068..11099109 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022498 (Txndc11) NM_029582 thioredoxin domain containing 11 Gene [Source:MGI (curated);Acc:Txndc11-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 33777063..33777104 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 8683621..8683662 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052551 (Adarb2) NP_443209 adenosine deaminase, RNA-specific, B2 Gene [Source:MGI Symbol;Acc:MGI:2151118]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3438889..3438930 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 17075875..17075916 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 9234264..9234305 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 19114788..19114829 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6096198..6096239 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 38703402..38703443 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039539 (Sgcz) NM_145841 sarcoglycan zeta Gene [Source:MGI (curated);Acc:Sgcz-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 39322488..39322529 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029924 (Slc37a3) NM_028123 solute carrier family 37 (glycerol-3-phosphate transporter), member 3 Gene [Source:MGI Symbol;Acc:MGI:1919394]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 5998530..5998571 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034690 (Nlrp4c) NP_113566 NLR family, pyrin domain containing 4C Gene [Source:MGI (curated);Acc:Nlrp4c-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 24061516..24061557 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 5402095..5402136 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 6635332..6635373 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 23305518..23305559 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 11609505..11609546 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 63241993..63242034 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046856 (Gpr1) NM_146250 G protein-coupled receptor 1 Gene [Source:MGI (curated);Acc:Gpr1-001]


Sequence tag IST10952D7HMF2
Sequence
AGTTCCANGNNNNCCAGGGCTACACAAAGAAACCCTGTCTCAAAAAAAAAAAAAAAAAAAA

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000046856


For any suggestions or comments, please send an email to unitrap@crg.es