Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AB0333
Clone ID AB0333
Vector pGT0lxr
Project sanger

Sequence tag AB0333
Sequence
ACTAGGGATCGGGCGGGTAAGGCGATGGACGAGGCTGAAACACCTTCTTTCAAAATGACCTGGAGCAGCACAACCAGCAG
TGGCTACTGCAGCCAGGAGGACTCGGACTCGGAGCTCGAGCAGTACTTCACGGCGCGTACCNCGCCGGTTTTTTTTTTT
Sequence Type mRNA
Unitrap ID UNI2968

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107457086..107457234 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010067 (Rassf1) NM_019713 Ras association (RalGDS/AF-6) domain family member 1 Gene [Source:MGI (curated);Acc:Rassf1-002]

 
Come back to gene ENSMUSG00000010067


For any suggestions or comments, please send an email to unitrap@crg.es