Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST469582
Clone ID OST469582
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST469582
Sequence
GAGGAAGAAGACGGACTTCGGGTGAGGAAGGCGATGCCGAGCAACAGCCCCGTGGCGGCTCTGGCGGCCACTGGGAAGGA
GGAGGGCCTGAGCGCCCGGCTGCTGGCCCTGGTGGTTCTGTTCTTTATCGTTGGTGTCATTATAGGGAAGATTGCCTTGT
AGGGGCCGCATGCGAAGGATGGCAGGTTGGATTGATGGATCTACCACACCATGGGATTCAAATTTATCATAACCATGCGT
AAAAAGAAATTAATGTATGACGGCATA
Sequence Type mRNA
Unitrap ID UNI15945

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 173603562..173603826 265
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054455 (Vapb) NM_019806 vesicle-associated membrane protein, associated protein B and C Gene [Source:MGI (curated);Acc:Vapb-001]

 
Come back to gene ENSMUSG00000054455


For any suggestions or comments, please send an email to unitrap@crg.es