Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11563E4
Clone ID IST11563E4
Vector VICTR76
Project tigm

Sequence tag IST11563E4HMF1
Sequence
TGGTGATGGTGAGTGGTCTTGGTTCCTGTTAGTAAGATTCCTCCGTTTACCTTTCGCCATCTGGTAATCTCTGGAGTTAG
TAGTTATAGTTA
Sequence Type genomic DNA
Unitrap ID UNI15225 UNI15232 UNI29644 UNI30806 UNI30807 UNI30808 UNI30809 UNI30811

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166335: 5719..5809 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166309: 114808..114898 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166307: 48337..48427 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166438: 134247..134337 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 2531232..2531322 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 20647471..20647561 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 10881085..10881175 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 11692031..11692121 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023826 (Park2) NP_057903 Parkinson disease (autosomal recessive, juvenile) 2, parkin Gene [Source:MGI Symbol;Acc:MGI:1355296]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 14814906..14814996 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4369558..4369648 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049148 (Plcxd3) NM_177355 phosphatidylinositol-specific phospholipase C, X domain containing 3 Gene [Source:MGI (curated);Acc:Plcxd3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 4074071..4074161 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033715 (Akr1c14) NM_134072 aldo-keto reductase family 1, member C14 Gene [Source:MGI (curated);Acc:Akr1c14-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 9689599..9689689 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 7826378..7826468 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 4771082..4771172 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 3176654..3176744 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 5255518..5255608 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019769 (Syne1) NM_022027 synaptic nuclear envelope 1 Gene [Source:MGI Symbol;Acc:MGI:1927152]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3912786..3912876 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 6938913..6939003 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042505 (Acn9) NM_001077713 ACN9 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Acn9-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 5110375..5110465 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3987177..3987267 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040407 (Akap9) NM_194462 A kinase (PRKA) anchor protein (yotiao) 9 Gene [Source:MGI (curated);Acc:Akap9-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 5641447..5641537 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049119 (1700012H17Rik) NM_173426 family with sequence similarity 110, member B Gene [Source:MGI Symbol;Acc:MGI:1916593]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 5054833..5054923 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 4906277..4906367 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 7843072..7843162 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 11616131..11616221 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057715 (A830018L16Rik) NM_177173 RIKEN cDNA A830018L16 gene Gene [Source:MGI Symbol;Acc:MGI:2444149]

 
Come back to gene ENSMUSG00000057715


For any suggestions or comments, please send an email to unitrap@crg.es