Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14303G10
Clone ID IST14303G10
Vector VICTR74
Project tigm

Sequence tag IST14303G10HMF1
Sequence
TTGGCAGACAGCATCGTGACATGGGCCACATCAGGCAAGGGGTANTCACGCCGATCACCGTAANTGGGGAAAGCATANTC
TTCACTCTTCACAACACTCCCTACAACACATTGGANAGGCCTGAAACCCCGTGTGGACGGCANTCTANGCAGAAGGGCGG
TGACNGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14303G10BBF1
Sequence
TTGGCAGACAGCATCGTGACATGGGCCACATCAGGCAAGGGGTAGTCACGCCGATCAGCGTAAGTGGGGAAAGCATAGTC
TTCACTCTTCACAACACTCCCTACAACACATTGGAGAGGCCTGAAACCCCGTGTGGACGGCAGTCTAGGCAGAAGGGCGG
TGACGGTCAACGGTTAAGACGGAAGCCTGACCTAAGCAGCCCCTCGGTCACCAGGGGCAGGACCAGGGCTGAGGGTTGTT
AGTCACACAAGCAACTGGACTAANTGGAGACCCAACCGCAGGGTCTCATACTNNNNNNNTAAAATTCNNAAAGGGAAAGG
CGACTGTTGCAGAGTCTTGGTGGTCACCGTGACCCTGGCAGCCNANGACNTACCAAGTGCCTACTGGTCACTGANGCTNA
CTCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123196321..123196723 373
 
EST/CDNA Est Name
  AV032923.1 - CR759626.1 - BF467195.1 - BQ563490.1 - BM210415.2 - CD776842.1 - AW557199.1 - BE985908.1 - BF466083.1 - CD776381.1 - BG065603.2 - CD774334.1 - BM119518.2 - AU040642.1 - BG796712.1 - AU021417.1 - CD802572.1 - BM114904.1 - BE981666.1 - AW107700


Sequence tag IST14303G10HMR1
Sequence
CCAGCNNNNAGGCNNTGAAGGAGAAGGAGAAGGCCGACTGGAGCAGCCTTTCCAGGGATGAGAAAGTTCAGTGTGGGTAT
CAGAGGGGGTGCACAAACACTCAGTAGTGTGTGGAGGCGATTGCACTGGGTCAGCTCTCCCAGCTGGGCTTCTAGATACC
CATTCCATACTGCTGGCTT
Sequence Type genomic DNA
Unitrap ID UNI6307

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123196721..123196899 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031818 (Cox4i1) NM_009941 cytochrome c oxidase subunit IV isoform 1 Gene [Source:MGI Symbol;Acc:MGI:88473]

 
Come back to gene ENSMUSG00000031818


For any suggestions or comments, please send an email to unitrap@crg.es