Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14626F8
Clone ID IST14626F8
Vector VICTR74
Project tigm

Sequence tag IST14626F8BBF1
Sequence
CTTACCAACTTTTTCTTTGGTCCTGGTATATACCAGGAAAAAAAAACTGCTCAAAATTTGCTGTGAAATATTGAGCAAGC
CAATTGCCTTCTCTGAAACTTGATTCCTTTCACTTTATTTATTTTTTTCTTTTGGCTTTTTTCNANACGGTTTCTCTGTA
TAGCCCTGGCTGTCCAGGAACTCACTCTGTGGACCTCGAACTCTAAAATCTGCCTGCCTCTGCCTCCCAAGTGCTGGGAT
TAAAGGCATGCNCCACCACTGGCCGGCAATTCCTTTCACTTTAAGGGGGCTAGCATGTGTGTAACCTCTCCTGCNCCTAC
ACATATCCTGATTGNATGTAATGCTTTATGCAAATGTTTCCCATTTGGCTCCATTCACTGTCCCCATTTCGCCGATGAAA
NACTCANGTTCAAAGACNCATGAAAGACTGAGGTAGAAANCATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164648817..164649259 423
 
EST/CDNA Est Name
  AA866739.1 - BQ956013.1


Sequence tag IST14626F8HMR1
Sequence
GTAAGAATTATAAGAATTTGTGAACAGAAAGGCCATGCAAATATTTAGAATGATTTTTAAAAAAGAATTAAATGTTC
Sequence Type genomic DNA
Unitrap ID UNI11597

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164649255..164649330 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017764 (Zswim1) NM_028028 zinc finger, SWIM domain containing 1 Gene [Source:MGI (curated);Acc:Zswim1-001]


Sequence tag IST14626F8HMF1
Sequence
CTTACCAACTTTTTCTTTGGTCCTGGTATATACCAGGAAAAAAAAACTGCTCAAAATTTGCTGTGAAATATTGAGCAAGC
CAATTGCCTTCTCTGAAACTTGATTCCTTTCACTTTATTTATTTTTTTCTTTTGGCTTTTTTCNAGACGGTTTCTCTGTA
TAGCCCTGGCTGTCCAGGAACTCACTCTGTGGACCTCGAACTCTAAAATCTGCCTGCCTCTGCCTCCCAAGTGCTGGGAT
TANAGGCATGCNCCACCACTGGCCGGCAATTCCTTTCACTTTAAGGGGGCTAGCATGTGTGTAACCTCTCCTGCGCCTAC
ACATATCCTGATTGGATGTAATGCTTTATGCAAATGTTTCCCATTTGGCTCCATTNACTGTCCCCATTTCGCCGANGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164648862..164649259 388
 
EST/CDNA Est Name
  AA866739.1

 
Come back to gene AA866739.1


For any suggestions or comments, please send an email to unitrap@crg.es