Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14758F8
Clone ID IST14758F8
Vector VICTR76
Project tigm

Sequence tag IST14758F8BBF1
Sequence
CTTACATTATGATTCATAACGGTAGCAAAATTACTGTTACAAATTANCGACGAAAATAATATATTTTTTTAAACTAACAA
GAGGATCGCAATTTACTTTGAAGTTAATGTCTACATAGATTGCTTGCAGCAAGGCCATCAATGAAAATGATCTTACGGTT
GGGGGACCCCGGCAGATGGGAGGTGTGAAGGCCTAATGACAGCATCATGAATTTTGTGAACAAAGACTTTAAATAAATTA
AAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 147933058..147933308 249
NO GENE  


Sequence tag IST14758F8HMR1
Sequence
TTAAGCAGGCAGGGTATTGGTGGGTCTGTGACCCATTATTTATCAACGACAGCTGCTTCTGATTGTTTACCCTTAACTC
Sequence Type genomic DNA
Unitrap ID UNI8892

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 147933305..147933381 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017264 (Exosc10) NM_016699 exosome component 10 Gene [Source:MGI (curated);Acc:Exosc10-005]


Sequence tag IST14758F8HMF1
Sequence
CTTACATTATGATTCATAACGGTAGCAAAATTACTGTTACAAATTAGCGACGAAAATAATATATTTTTTTAAACTAACAA
GAGGATCGCAATTTACTTTGAAGTTAATGTCTACATAGATTGCTTGCAGCAAGGCCATCAATGAAAATGATCTTACGGTT
GGGGGACCCCGGCAGATGGGAGGTGTGAAGGCCTAATGACAGCATCATGAATTTTGTGAACAAAGACTTTAAATAAATTA
AAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 147933059..147933308 250
NO GENE  

 
Come back to gene ENSMUSG00000017264


For any suggestions or comments, please send an email to unitrap@crg.es