Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST469299
Clone ID OST469299
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST469299
Sequence
CCTTCACAACAACGTGAGCGTGGCCTACGAGTGTCTGAGTGCCAGCGGCCGCAAGAAGAAACCGGGGCTGGATGGGCGCA
CGTACAGCGAGCTGCTGAAGCTGTGTTTGCAGGGACCGGCGGGGCCGCCTGAGGAGGTGGTGGCGCCACTGCTTCGCAAG
ATCCAGTGCCGGGACCATGAGGCTGTGCCTCTGGGCATCTTCAGAACCGGCATGCTGTCCTGCTTTGTGCTGCTGGAATT
CGTGGCACGCGCCGGCGCCCTCTTCCAGCTGCTGGAGGACCCTGGTCAAGCGGTGGCCGATCGNCGTGTGGNCCAGGNCG
TGCTGGACACACTGGAGGGTGCGCTGAGCGCAGGAGACATGGCAACAGCACCCACNCACTACCTGGAGGCCGGTTCGCGC
TTGGGCCCTGACAACANTGGNNCGTNCCCTGNACAGGGCAGCAAGCGGGCGGCGACCCAATGTGCCCATGGCCCGCCGAG
GAGTTCC
Sequence Type mRNA
Unitrap ID UNI14420

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 79138150..79138632 444
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020308 (Gtrgeo22) NM_148934 gene trap ROSA b-geo 22 Gene [Source:MGI Symbol;Acc:MGI:106618]

 
Come back to gene ENSMUSG00000020308


For any suggestions or comments, please send an email to unitrap@crg.es