Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10993G11
Clone ID IST10993G11
Vector VICTR76
Project tigm

Sequence tag IST10993G11BBF1
Sequence
TTAGTGCATGGATGCTTTTGTCATTGTGAGCCCTAGGATTTGCCTGACTGCTGATGTCNGAGAGGAGCTTACTTTTTTTT
TTTG

Sequence Type genomic DNA
Unitrap ID UNI5543

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45561566..45561648 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023932 (Cdc5l) NM_152810 cell division cycle 5-like (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:1918952]


Sequence tag IST10993G11HMF1
Sequence
TTAGTGCATGGATGCTTTTGTCATTGTGAGCCCTAGGATTTGCCTGACTGCTGATGTCAGAGAGGAGCTTACTTTTTTTT
TTTG

Sequence Type genomic DNA
Unitrap ID UNI5543

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45561566..45561648 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023932 (Cdc5l) NM_152810 cell division cycle 5-like (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:1918952]

 
Come back to gene ENSMUSG00000023932


For any suggestions or comments, please send an email to unitrap@crg.es