Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14722D5
Clone ID IST14722D5
Vector VICTR76
Project tigm

Sequence tag IST14722D5HMF1
Sequence
TTCAGAGCCACCCTCAAGCTGGGTACAGTACCTGCCTGGCCCTGATAGCTCACCATGTATTGGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 38946423..38946490 68
NO GENE  


Sequence tag IST14722D5HMR1
Sequence
AACACTAGTTAGACTCCTCCAATTCCCTCTTTCAGCATGGTATAGTCTGGGGCTTGGCCCAGGCATAAGTTCTGCTGTGG
ATGTGTGAAGGTATGTGTACTGTGTTGGAGCTGGGTTACTGCAGTAACACAGGGTTC
Sequence Type genomic DNA
Unitrap ID UNI1301

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 38946289..38946424 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005103 (Wdr1) NP_035845 WD repeat domain 1 Gene [Source:MGI Symbol;Acc:MGI:1337100]


Sequence tag IST14722D5BBF1
Sequence
TTCNAGCCCCCTCAAGCTGGGTACNNTACCTGCCTGGCCCTGAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000005103


For any suggestions or comments, please send an email to unitrap@crg.es