Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10815F2
Clone ID IST10815F2
Vector VICTR76
Project tigm

Sequence tag IST10815F2HMR1
Sequence
NNNGGNNNANATTGGCAGATAATGAAGATGTATCTGAAAACTGGTTCTTACTCATATTTTACGTGTGTGTGTGTGTCTAT
GTGTGTTTGTGTGTGTGTACATGCATTCTGTGTGTATGGTGGTGGCTTTGTATCTTTCTGCTTCCAGGGGACATGATGAC
TTTANTGATGAAAAAANATNCNCNGACNNAANAA
Sequence Type genomic DNA
Unitrap ID UNI31948

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29119092..29119268 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024006 (Stk38) NM_134115 serine/threonine kinase 38 Gene [Source:MGI (curated);Acc:Stk38-001]

 
Come back to gene ENSMUSG00000024006


For any suggestions or comments, please send an email to unitrap@crg.es