Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14513H11
Clone ID IST14513H11
Vector VICTR74
Project tigm

Sequence tag IST14513H11BBF1
Sequence
ATCTTAAACTCCAAAGGGAGAGGCCAGCCAAGACCAGAGACCCTTTTAAAAACGGGGTAGGTGCCGGGCGTGGTGGCGCA
CGCCTTTGATCCCAGCACTCGGGAGGCAGAGGCAGGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTAGTTCCAGGACAG
CCAGGGCTATACAGAGAAACCCTGTCTCGAAAAAACAAAAAAACAAAAAAACAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77926657..77926878 222
NO GENE  


Sequence tag IST14513H11HMF1
Sequence
ATCTTAAACTCCAAAGGGAGAGGCCAGCCAAGACCAGAGACCCTTTTAAAAACGGGGTAGGTGCCGGGCGTGGTGGCGCA
CGCCTTTGATCCCAGCACTCGGGAGGCAGAGGCAGGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTAGTTCCAGGACAG
CCAGGGCTATACAGAGAAACCCTGTCTCGAAAAAACAAAAAAACAAAAAAACAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77926657..77926878 222
NO GENE  


Sequence tag IST14513H11HMR1
Sequence
AAGANGACTTTGAACTTTANATTCTGTCTCTAGCAAGTGCTGGGAATATAAGCCAGTGGCTAGTACTCAGCCCTTGACCT
CACGGATCTCATATACCACTTCGTGCTCTTTGAATACTTTCTCCTTTGCTTTTATTCTTTTTCTTAGTGGCTTGTAAAAA
TTCCTTGTATATTGTTGGCATCAACTCTTCTTAATAAGCATTGCAAATACCCTTTTAGGCTATGAATAGGAAGTGAGAAG
GCAGCCTCTTGCAGCAAATGCTAATTCAACATGGTGTTC
Sequence Type genomic DNA
Unitrap ID UNI563

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77926874..77927151 274
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037750 (BC017647) NM_145430 Uncharacterized protein C17orf63 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6P539]

 
Come back to gene ENSMUSG00000037750


For any suggestions or comments, please send an email to unitrap@crg.es