Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14893G10
Clone ID IST14893G10
Vector VICTR76
Project tigm

Sequence tag IST14893G10HMF1
Sequence
GGACAAGTCACTGTTTTAACAGCCGCAGCTCCCCAGTTGTTCTAGGTAGGTCCGTTCATGCTGGACCATTGGGACAACTG
GGTAAAAAGAGTTTCTGATGTTGGTGGGATACTAGTTGGGGGAGATGANTCATGGACCCCCAGGTAACAGGNNACCTTAN
AAGANNANTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 56500698..56500861 154
NO GENE  


Sequence tag IST14893G10HMR1
Sequence
TTCCTGTTCGTGAGGGTGTGAAACAGGGACTGCAGGACNACAGCATGCTGAAGAGAAATAAATTCAAAGCTGGGCATAGC
AGTCC
Sequence Type genomic DNA
Unitrap ID UNI35564

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 56500618..56500700 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040380 (Cbln3) NM_019820 cerebellin 3 precursor protein Gene [Source:MGI Symbol;Acc:MGI:1889286]

 
Come back to gene ENSMUSG00000040380


For any suggestions or comments, please send an email to unitrap@crg.es