Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST469260
Clone ID OST469260
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST469260
Sequence
ACTGAGGAAAAGGAGGCAAAAACCGGCGTAGNGGCAAAAATGAGAATGAATCTGAAAAGCGAGAGCTTGTGTTCAAGGAG
GATGGGCAAGAATATGCTCAAGTAATCAAAATGTTGGGAAACGGACGATTAGAAGCCATGTGTTTTGATGGTGTAAAGAG
ACTGTGCCACATCAGAGGGAAATTGAGAAAAAAGGTTTGGATAAATACCTCAGATATCATATTGGTGGGGCTACGAGATT
ACCAGGACAACAAAGCCGATGTCATTTTAAAATACAACGCAGATGAAGCTAGAAGTCTCAAGGCCTATGGCGAGCTTCCA
GAGCATGCTAAAATCAATGAAACTGATACATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNATCTAAAGCGAACTCAACATTTTACATTCCAGTCTTCCGGAAGATTGTCCTTCAAGTTTGG
AATCTGGCCATAGACCTCAAAGAAAAATTCCG
Sequence Type mRNA
Unitrap ID UNI15963

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 155814311..155823429 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067194 (Eif1ay) NM_025437 eukaryotic translation initiation factor 1A, Y-linked Gene [Source:MGI (curated);Acc:Eif1ay-001]

 
Come back to gene ENSMUSG00000067194


For any suggestions or comments, please send an email to unitrap@crg.es