Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12641D1
Clone ID IST12641D1
Vector VICTR76
Project tigm

Sequence tag IST12641D1BBF1
Sequence
CCCACGAGATGGCAAGTAACTGCAATCATAGCAGAAATATTATACACACACACACACACAGACTCTGTCATAAAATCCAA
TGTGCCTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12641D1HMF1
Sequence
ATGTAACAACAAGAGGTTTTTAATGGCGGAGCTCCGGGTCGAAACGTATCTCACATAACAGGAGACAGTGGATTCNACCA
CGANGCTTGNAANCTAGGGGTN
Sequence Type genomic DNA
Unitrap ID UNI3595

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 31863228..31863328 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001855 (Nup214) NM_172268 nucleoporin 214 Gene [Source:MGI (curated);Acc:Nup214-001]

 
Come back to gene ENSMUSG00000001855


For any suggestions or comments, please send an email to unitrap@crg.es