Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST469199
Clone ID OST469199
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST469199
Sequence
CAGGACATCTTCTCCATTTGGACCAGGGCGTGGTAGAGAAAAAAGAATGTCTAATGAGTTGGAAAGTTATTTTAAGCCTT
CAATGCTTGAAGACCCTTGGGCTGGCCTAGAACCAGTGTCTGTAGTGGATATAAGCCAACAGTACAGCAATACGCAAACA
TTCACAGGCAAAAAAGGAAGATACNTTTTCTTAATATTTCTGAAATTCACCTGGAAGCTTCATGTGTNAGGAACATCCTG
GACAGAACTTTTACTTGTGTAAAAGAGTTGAACCCAAGGATGATGACTTTGAATAATGATTAGCAGACCTTTGGTATATC
TCCAACTTTATCAAGTGTTGATAACAGCGGAAATGATAGGACAATTTACAGTATTTAGCTATCTGGGAGTGTGTATCATA
GAACACAGTTNTCATATTTGACATTTCCAATATAACAGACATTTGTTTTTTTCAATGTTTTAAAATAAAACGTTTNTTGT
CTTCCTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI15966

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 17788685..17789170 471
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000012429 (2810021B07Rik) NM_025479 RIKEN cDNA 2810021B07 gene Gene [Source:MGI Symbol;Acc:MGI:1913558]

 
Come back to gene ENSMUSG00000012429


For any suggestions or comments, please send an email to unitrap@crg.es