Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14153D9
Clone ID IST14153D9
Vector VICTR74
Project tigm

Sequence tag IST14153D9HMF1
Sequence
CCAGTATTACCCATCTTCAGCCCCATTCCAGCCACTCCAAGCCACACCCCCAGAACGCCTCAGCCTATCAGCTTCCATGT
CCCGAGGGCCACTGAACTACATTTCCCAGAAGGTGTCTCGGCAGCGCCGCACAAACTTCCGGCCAGGAAGATGGCGGCTT
CCTAGAGTCCTGATTGACTGGCCGCGGTGCCCAGGCTACAGAGTGGAACCTGCGGCACTGTGAACGCGCGTGAGCTTTGT
GTCGCCGTGGTCTAACTTCGACCCGGATTGCTGTAGCTCCAGGTTCGTTCTTCTTGANGACTTANGGGTGGGGGATTCNA
NGTCCCGANATGCCNCCCCTAAAACCGCGCATCCNTCGCAGGGTCACTTGGGCTTCCTGTGTTTCCCTANGGACCGGACC
NGCNCCNCCTCNNGGGAAAAGTANTTTTGGGAAACTTCNACTGTATCTTTTCGN
Sequence Type genomic DNA
Unitrap ID UNI35567

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 73920638..73921090 423
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031820 (5430437P03Rik) NM_026636 RIKEN cDNA 5430437P03 gene Gene [Source:MGI Symbol;Acc:MGI:1915501]

 
Come back to gene ENSMUSG00000031820


For any suggestions or comments, please send an email to unitrap@crg.es