Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14520B5
Clone ID IST14520B5
Vector VICTR74
Project tigm

Sequence tag IST14520B5HMF1
Sequence
NAANANCCTCNNTGCTCTTAACNNNNNANCCNTCTCTCNANCCCCTCCATGTTTGTTATANCTTGGTTTCCTCTCTCCTC
TGTCTTTGNCTNNGTCNNTGTCNCTCNCNNNCCTNTCNCTCTGNNNTNGTGTGTNTNNCNGTTTCNACATCTTCTGTCTC
TGTCNTTCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14520B5HMR1
Sequence
TTCTGAAGGTCCTGAGTTCAATTCCTGGCAACCACATGATGGCTCACAACCATCCATAATGAGATCTGACTCTCTCTTGT
GGNGNGN
Sequence Type genomic DNA
Unitrap ID UNI12836

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7589025..7589106 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031163 (Glod5) NM_027227 glyoxalase domain containing 5 Gene [Source:MGI (curated);Acc:Glod5-001]

 
Come back to gene ENSMUSG00000031163


For any suggestions or comments, please send an email to unitrap@crg.es