Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12775H5
Clone ID IST12775H5
Vector VICTR76
Project tigm

Sequence tag IST12775H5HMF1
Sequence
CATGCATTATAAGAATGAGACAATTAGCTAGGTCTAGTTCCCACTCAGCACGAGATGCTGAGTCAGGAGGATCAGGGGTT
TCAAAATACCCTTTGCTGTAAAGTAGGTTCCATATAAGCTAGGGATACAGTGCTGTGAGACAGCTAGAATGAGGAAGTGC
TGCCAGCAGGACCCTGGACTGCAGGGATCTCTAGAGTCTACAGGGGTAGGGAAGTGGGGGACAGCACTCTGGCAGGAGGC
CNCACAGATGTGGCCTANCAGGCCCTGCTAAGGGATTGGCTTGGA
Sequence Type genomic DNA
Unitrap ID UNI10673

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 86955469..86955752 278
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041734 (Kirrel) NM_130867 kin of IRRE like (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1891396]


Sequence tag IST12775H5BBF1
Sequence
ATGCCTTGCTGGGCTTGGCTGCCGGAAAGGAGGCCTGATCNTGCTGACTCNTGGCGCTGGCTGCCCNGNNNGN
Sequence Type genomic DNA
Unitrap ID UNI32367

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 129506779..129506844 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029428 (Stx2) NM_007941 syntaxin 2 Gene [Source:MGI (curated);Acc:Stx2-001]

 
Come back to gene ENSMUSG00000029428


For any suggestions or comments, please send an email to unitrap@crg.es