Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12125D8
Clone ID IST12125D8
Vector VICTR76
Project tigm

Sequence tag IST12125D8HMR1
Sequence
CTAAGGCCTGGCGAGATGGCTCAACAGTTAAGAGTTCAAGCCGCTCCCACCTGCCCAGCTCCAGAGAGAGCCAACCTTGG
TCTCCTCAGCACCAGCACATGGCCTCCCTCACCCGCACCCCCTCCCAACCACATATACACACATAATTCAAAATAACATA
CGTCTTGGAGCTGGTGGTCCACCAAACTCAGTTACCACCCAGGCCCAGGCCCAGATCCAGGGGTTTGAGTTANCCCACCC
CAACATCTACCCCATCTATNANCTGCTNNAGGGTGTGAAGGGGCTGGTCCTGAACATCCAAAGCTGCGGGATCTCCATGA
TACAGGGTCACAACGGGATATCTGAGAGGAGTCCTGGCAAGGATCCNGTGTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66455505..66455876 360
NO GENE  


Sequence tag IST12125D8BBF2
Sequence
TTTCCTTAGAAAGACATTTTAAGCAAATAACCGGTGGAATTCCCAATCTCTAAGTTAAGACCCAGAAAAAAACAGAGGTT
AAGATGGTTTGTAGATGAAGAATCATTTCAATTTTTTTTACTTTATGGTGTTTTCGAAACTTAGCCTATATGGCAGAACA
CAAGAAATACTTTGCATCTTTTGTGTTCCTACTGTGAACAGCTCTGAAGTTCTGAGGAAGGAACCTTGGAGTTTTCTTTA
CTCCAAAGACACTGAACTCCGCTGCTTTANTTGTCTGANAAAAGGAAGTTATGTGATTATGAATTCCGAATAGCAGAATA
GTCNCAGCCTANNCCTCCNANGACCNAATATGNNAGANAAANATTTANAAATTANNGTCNATTCACCATGTGCNNNANAG
AANGTTTTGTGATCCCTGTCCCCCCGATATTTNCTNATTTTTAACTGGATCTCAAACTAACAGCATTNAAGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12125D8HMF2
Sequence
GGTGTAGCAGTCTGGTGAGCATACAGCNAAGCATCTGTCA
Sequence Type genomic DNA
Unitrap ID UNI13540

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 74023539..74023577 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034845 (Plvap) NM_032398 plasmalemma vesicle associated protein Gene [Source:MGI Symbol;Acc:MGI:1890497]

 
Come back to gene ENSMUSG00000034845


For any suggestions or comments, please send an email to unitrap@crg.es