Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15093F6
Clone ID IST15093F6
Vector VICTR80
Project tigm

Sequence tag IST15093F6HMF2
Sequence
ATGCTTTCCAAGAAGCAACAGTAAAAGCGTTTAGGAATGACGGCTAGACGTCTCCAGGAGAAACTTACAAACTCAGTGCA
CCTCACACCAGGTGCTAAGCTTTGGCTGGCATTCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 130766026..130766171 142
NO GENE  


Sequence tag IST15093F6BBF1
Sequence
ATCTCCCTNNCNNNGTACTAGGCAATCTTAAACCTACTACTGATCCACGTGTAAGTCTGTCTTCTTGTTTTTTGAGAGAA
GGTTGGTTTCTCTACATTGCCCTGGTTGTCCTGGAACTCACTCTGTAGACCAAGTTTATGTAGACCAGGCTGGCCTTGAA
CTCAGAGATTCATCTGCCTCTGCCTCTTGAGTACTAGGCCCACCACTGAGTGTGAGCCACCCCTGCCTGGCCTGGTGGAT
AAATTTAAATGTTTGATCAAAGCACAGGCCAACAGCCTGCCCCACTCAGGATGGTGGAGTCAGTGCAGTGTAGTGACAGA
AGGAAGAGGGGACAGACAGCCTGCTCTAAGTGAGAGGTTTCTGAAGGTGGTTGTTN
Sequence Type genomic DNA
Unitrap ID UNI14099

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 133217845..133218205 361
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043257 (Pigv) NM_178698 phosphatidylinositol glycan anchor biosynthesis, class V Gene [Source:MGI (curated);Acc:Pigv-002]

 
Come back to gene ENSMUSG00000043257


For any suggestions or comments, please send an email to unitrap@crg.es