Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12571B3
Clone ID IST12571B3
Vector VICTR76
Project tigm

Sequence tag IST12571B3HMF1
Sequence
AGATGATACTATTCTATAACAAGAAAATGTACTCAGAGCAAACCACTACTTTAAAACTCTTAGACATGAAGTAATGCACA
AGAAGACTCTCAGGCCAGGGAGAATTTGATGTTGGTGTGTTAATACCAGGTGATTGCACATGCCCAGGCAAGTGCTTGAC
ACTGAGAGTAAACAAAGTTTACATCCTAGGTGGCTAACNCCNGCATCNTAN
Sequence Type genomic DNA
Unitrap ID UNI20547

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86321073..86321282 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020516 (Rps6kb1) NM_028259 ribosomal protein S6 kinase, polypeptide 1 Gene [Source:MGI (curated);Acc:Rps6kb1-001]


Sequence tag IST12571B3BBF1
Sequence
AGATGATACTATTCTATAACAAGAAAATGTACTCAGAGCAAACCACTACTTTAAAACTCTTAGACATGAAGTAATGCACA
AGAAGACTCTCAGGCCAGGGAGAATTTGATGTTGGTGTGTTAATACCAGGTGATTGCACATGCCCAGGCAAGTGCTTGAC
ACTGAGAGTAAACAAAGTTTACATCCTAGGTGGCTAACTCCGGCATCTTATCTCTGTGTCTCATTTGAACTCTTCTTCCA
TAGTTATCCTTATCTAGACTTACTGTAGATATACAACAGCCGTTGAGCACATTATTATCTCTAGGAATTTATTGAGTGAN
TAGATGCACTAAAGGGTTATGAAGGAAAACTGATACTCAGTTTTAAGAAGAATGGTAACTATCTACTGAAATTTATGTTN
ATTNATATATAAAATTTGAAGATGTAGGCTTTGGTTCACTGGTANAACATTTGCTTGCCTANCANGGGTGAANCTCTGGG
TTTGAACTCN
Sequence Type genomic DNA
Unitrap ID UNI20547

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86320794..86321282 475
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020516 (Rps6kb1) NM_028259 ribosomal protein S6 kinase, polypeptide 1 Gene [Source:MGI (curated);Acc:Rps6kb1-001]

 
Come back to gene ENSMUSG00000020516


For any suggestions or comments, please send an email to unitrap@crg.es