Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15058E1
Clone ID IST15058E1
Vector VICTR80
Project tigm

Sequence tag IST15058E1HMF1
Sequence
CCATCAGCTCCATTTCCCTCTCTGCTTCCGGCTTGTGTTTGAAGAGGTGAGCGCTCAGCTTCGGGCACCTGTAGCCATGT
CTGCTGCTTGCCTCCTTGCCACGACAGGCTCATTCCTCTGGAACCGTCAGCCCAAATAAATTTCTTGTAGAAGTTGCCTT
AGTCATAGTGCTTTATCCCAGCAAGAAAAAAGTAATCTACACACCTTTCTGTAAGCAGCCCGAAGGTGACTTTAATGCCT
TTTTTCACTGTGCTTGTGTCTTGATCTCAGCCCATTACATTAGGTATAGAATTTGCTACCCCTATTATCAAATCAATGCT
CAAAAACTTGCATTCTGGGCTGGTGAGATGGCTTAGTGGGTAAGAGCACCAATTGCTCTTCCGGANGTCATGAGTTCAAA
TCCCANCANCCNCATGGTGGCTCACAACCATCTATNATNNNAANCAAATAATAAAGAATCNNTGGGCCNNANGGANCNGG
ANAAAGGGAAANAGGGGAGGGAAAAAAGTTAANNNTTNNNAAAAAACNAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15058E1HMR1
Sequence
ATGGGAAGTTTTTAATTTTTTAATTTCTAAGTCCGCCTCCAGGGACACACAAGGCTATACCACCTAAACCTCCCCAGACA
GCGACCAGCTAGGGACCAAGTGTCCAAATGCCCCAGGCTATGGGAACATTTTTCAGTCGAACCTTCAGAGTATGCATGAA
ACAGTGGGACTTTAGTTTTGGATACTTTAAGGGGCAGGTGTGGCGGTCTCTTTAGTGTCCCAGCACTAGAGAGAGGGGAG
GCAAGAAGAATAGCTTTGCCGGGTATGGTGGCGCACACCTGTAATCCCAGCACTAGAGAGAGGAGAGGCAAGAAGAACAG
CGTCTACTATATAGAGTTTGNNNNNNNCCTANACTANCTAANACCCTGCNTTTTAAAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI14364

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71186567..71186952 364
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027010 (Slc25a12) NM_172436 solute carrier family 25 (mitochondrial carrier, Aralar), member 12 Gene [Source:MGI (curated);Acc:Slc25a12-001]


Sequence tag IST15058E1BBF1
Sequence
CCATCAGCTCCATTTCCCTCTCTGCTTCCGGCTTGTGTTTGAAGAGGTGAGCGCTCAGCTTCGGGCACCTGTAGCCATGT
CTGCTGCTTGCCTCCTTGCCACGACAGGCTCATTCCTCTGGAACCGTCAGCCCAAATAAATTTCTTGTAGAAGTTGCCTT
AGTCATAGTGCTTTATCCCAGCAAGAAAAAAGTAATCTACACACCTTTCTGTAAGCAGCCCGAAGGTGACTTTAATGCCT
TTTTTCACTGTGCTTGTGTCTTGATCTCAGCCCATTACATTAGGTATAGAATTTGCTACCCCTATTATCAAATCAATGCT
CAAAAACTTGCATTCTGGGCTGGTGAGATGGCTTAGTGGGTAAGAGCACCAATTGCTCTTCCGGANGTCATGANTTCNAA
TCCCAGCAACCNCATGGTGGCTCACAACCATCTATAATTNGAAACNAATAATAAAGAATCTATGGGCCANATGGAGCANG
AGAAAGGGAAAGANGGGAGGNAAAAAAGTTAAAATTNNANNANAACAAACTTNCNTTCNNAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71186949..71187487 501
 
EST/CDNA Est Name
  BI733615.1 - CF724290.1 - CA316878.1 - CV563121.1 - BG919080.1 - BI649238.1 - CX123714.1 - BY741168.1 - BE912090.1 - BY734667.1 - BB618078.1 - CJ092515.1 - BB653264.1 - BF137858.1 - CX123275.1 - BQ942112.1 - BU918225.1 - BE533043.1 - CA555919.1 - BE310301

 
Come back to gene BI733615.1 - CF724290.1 - CA316878.1 - CV563121.1 - BG919080.1 - BI649238.1 - CX123714.1 - BY741168.1 - BE912090.1 - BY734667.1 - BB618078.1 - CJ092515.1 - BB653264.1 - BF137858.1 - CX123275.1 - BQ942112.1 - BU918225.1 - BE533043.1 - CA555919.1 - BE310301


For any suggestions or comments, please send an email to unitrap@crg.es