Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST468427
Clone ID OST468427
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST468427
Sequence
GGAGAAAATGGTTGGCTGTTGGCTTTTCACCTCTGGTCCTGTGTCACTGAGCGTCAAGATCGAGAGAAAGGGCTACTGTA
ACCGGAGAAGCTATCCCTATCTATGCAGAAATAGAAAATTGTTCATCTCGGCTGGTTGTTCCCAAGGCAGCCATATTCCA
AACCCAGACGTACTTGGCTAGTGGAAAGACAAAGACAGTCCGGCACATGGTTGCCAATGTTCGAGGAAACCACATTGGTT
CTGGGAGTACGGACACCTGGAATGGGAAGATGCTGAAGATCCCACCTGTCACCCCATCCATCCTGGATTGCTGCATCATC
AGAGTGGACTACTCCTTAGCTGTAATCCAAGCTTCTTGAATCATTAAAAATACATAAAACAGAGCA
Sequence Type mRNA
Unitrap ID UNI15994

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 75886486..75887540 303
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042659 (Arrdc4) NM_001042592 arrestin domain containing 4 Gene [Source:MGI (curated);Acc:Arrdc4-001]

 
Come back to gene ENSMUSG00000042659


For any suggestions or comments, please send an email to unitrap@crg.es