Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15092A10
Clone ID IST15092A10
Vector VICTR80
Project tigm

Sequence tag IST15092A10BBF1
Sequence
TTCATGAAATATTCCTCCGTTAATGCTTTTATCTTCACCTCATAATTTGCTAAACTATGTAAAGATGGGGTTGAGAGAAG
GTGGGGAGGAAGGAATTTTAATAAGAAAAAGTAAAATAATCGGAGCAGGCTGAATTCAGGGTGCTGTGTGTCACGTGGTT
TGGGGGCGGGAGGAGAGAGAGCACAAAGACCCCTGCTGCCCATCACAGAGGCAAACCCTGGAATTGAATCCTGAAAGTAT
TTATTCATAAAGCCCTCAGGCTGGAGAGCCGGGTGGGATCGGCCGCCTCAATCCTTTCCTCATTAGCATTTTTATAGAGA
AGAACTAAGAAATCAATTCAAGGTCCTGGCTTATCCTTCTGGCCNGGTGGCTTTTGTCTCGCAGGTCCCCTCCCCCTTAT
CTTTCTGCCACTCTGANTGGCTGGGGTATTNATGGACAGCAAANCTAGANGCTTGCNCTTCTCCTATACCTAANTTTAAA
AAAAA
Sequence Type genomic DNA
Unitrap ID UNI13863

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84886532..84887015 470
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]


Sequence tag IST15092A10HMR1
Sequence
ATGAAAANNNNNNCNCTTTGCTTTGTGCATTTANTTTTACTTTTTTAANTGGNGGTTTTTAGGGTTAGGTTAGGGACAGG
ATCTCTTTATGCNNTCTTGGCTGGGCTGAAACTACCTATGTANANCANACTGNCCTCANACTCNCTGANGTCCATTTGCT
TATGGCTCCCCANTGATGGGATTAAAGGCANCANCCACCATGCNNAGGAGATAGTCACTCACAAACAATAGACTAATGGA
ATGCTTGACATAAACAGATTTAATGCANAGGCAAAAAAAAGGTCAGCCAGCTGTATCTGAGGGGGTACAGCAAAGAAACT
GCCTACATGACTGCTCCATTANAGGTCAGGTTTTTTTGTGGTTAANANAAAAAANATCTANAGGCATCTGGAGGANTCTA
GGACTGANAANANCAAATGGGATGTGGCCNGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15092A10HMF1
Sequence
CATGAAATANTCNNCCGTTAATGCTTTTATCTTCACCTCATAATTTGCTAAACTATGTAAAGATGGGGTTGAGAGAAGGT
GGGGAGGAAGGAATTTTAATAAGAAAAAGTAAAATAATCGGAGCAGGCTGAATTCAGGGTGCTGTGTGTCACGTGGTTTG
GGGGCGGGAGGAGAGAGAGCACAAAGACCCCTGCTGCCCATCACAGAGGCAAACCCTGGAATTGAATCCTGAAAGTATTT
ATTCATAAAGCCCTCAGGCTGGAGAGCCGGGTGGGATCGGCCGCCTCAATCCTTTCCTCATTAGCATTTTTATAGAGAAG
AACTAAGAAATCAATTCAAGGTCCTGGCTTATCCTTCTGGA
Sequence Type genomic DNA
Unitrap ID UNI13863

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84886534..84886893 354
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]

 
Come back to gene ENSMUSG00000073633


For any suggestions or comments, please send an email to unitrap@crg.es