Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AB0216
Clone ID AB0216
Vector pGT0lxr
Project sanger

Sequence tag AB0216
Sequence
TCATTTCCTTCTTCGTCCCTCTCTGGCCACTATGGAATTCTAACCTGAGCCATGTTCGGACTGAAGCCGCCTCTCTATTA
CTTACCAG
Sequence Type mRNA
Unitrap ID UNI2407

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123012964..123013051 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031822 (Gse1) NP_941073 genetic suppressor element 1 Gene [Source:MGI (curated);Acc:Gse1-002]

 
Come back to gene ENSMUSG00000031822


For any suggestions or comments, please send an email to unitrap@crg.es