Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10439B5
Clone ID IST10439B5
Vector VICTR76
Project tigm

Sequence tag IST10439B5HMR1
Sequence
GTTTTTAGGGGTGAATCNATGGTTAGATAGTTTAGGGGAAAGGAGTAGGAAAATCCAGGATGGACAAAGGTCATTGGCTG
AAGGCTAANCTGAGCCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135169237..135169332 92
NO GENE  


Sequence tag IST10439B5BBF1
Sequence
AAACGTTGGTCTGTCTCCCTAAAACTGATCCTGGAATGACTTCATTTTCTTTTGTACTCACAGGCCATCCAATACCCTGT
TCAACCACTCTGCCCACTTCGTCCACGTGGGCCNATGGCCNATGGCCCTGGGGAGAAGGGANACCCACGGTGGTGCATGC
CTGANCACTCTNACACATATAAACAAATATATAATAAAAAACAATCAATACNAAGGGAGCCGGTATCTATCTCCGGACAC
NTTCTCTGATAATGAGTATTATTTGTACCNNNNANCTCTTTCATTTCACGCATACTGTTGGGAATTTTCTCCCACATCCT
CGTCGTTTTACAGCACTGGGCACTGTTCTCGGGGCCTTGCATATCCCACCACTGGGCCGTATCTGCAGCCTCTGATCCAC
AGCCCACATTCTCAGTGTTAATCGTCTGACTTTCCTANGCCAAGANTTCATTAATTTN
Sequence Type genomic DNA
Unitrap ID UNI7878

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135169329..135169785 429
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028164 (Manba) NM_027288 mannosidase, beta A, lysosomal Gene [Source:MGI (curated);Acc:Manba-001]

 
Come back to gene ENSMUSG00000028164


For any suggestions or comments, please send an email to unitrap@crg.es