Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14224G11
Clone ID IST14224G11
Vector VICTR74
Project tigm

Sequence tag IST14224G11HMF1
Sequence
CACCCAAGGTCAAGATACTATCTTACCATGCAAGAGTCTGGCTGGCTTCCTGGCCTCCCTTCTCCCTTCCTACCAAGCTA
ACAGGAAAGAAAATTTGACCGAGTCCTTCCCATTAAGCCTTTCAGAGGTTCCACTACCTACAGAATCAATCAGTTCTTCT
TCAGCAAGGTCTCCGAGGCCCACCGATACTCACATCAGGCTCTCTGAGCCCCCATCTCTGGACCACCTTCCTCCTGCAAT
CTACCCATCCCTCTCAGATTCGTTATAGCTCTAAATATTTCCATCCACTGCTCATGCTGTTGCTTTGGCTACAACCCATC
TGTGATGGCTAATCTTAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59470599..59470938 340
NO GENE  


Sequence tag IST14224G11HMR1
Sequence
GGTGGGAACGGGAAGCATGGGTCGATTGAGAAGATGAAATCNGTGATTGATTGATAAGTACACAGAAGGAAGAAGGAAGG
ATCTGTCTAGAGTACTGGTCAAGATCTCTGTGTAAATAATGGTGAGGGGGACACCAGTGTGAAGGAACAGAATAGACCCC
TCTCTGGGAGCATGAGGAGTANAGGGATCTCGGTAGGGAAGTTGGATCTT
Sequence Type genomic DNA
Unitrap ID UNI8198

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59470935..59471144 206
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035168 (Tanc1) NM_198294 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI (curated);Acc:Tanc1-001]

 
Come back to gene ENSMUSG00000035168


For any suggestions or comments, please send an email to unitrap@crg.es