Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12466G8
Clone ID IST12466G8
Vector VICTR76
Project tigm

Sequence tag IST12466G8BBF1
Sequence
TTAGTAGTTATAGTTGACTCTGTTTAGAGATTGTTCTTCTGGTGATTCTGTTACCGTCTATCAGCAGACCTGGGAGACAG
ATTCTCTCCTCTGAGTTTCAGTGCTCAGAGCACTCTCTGCTGGCAAGCTCTCTTACAGGGAAGGTGCGCAGATATCTTGT
ATTTGGACCTCCTCCTGGCCGAAGAAGAAGGCCCAAAACAGGACCTTTCTCAGACACTGTGTTGCTTTGGCAGTTCCCAG
GTGGTACAGACTCTCACCTAAGCAGACTAAATTCCTAAGTTCCTTGGAGTCCCGGGACCAAGATGGCGACCGCTGCTGCT
GTGGCTNAGGCCGCCTCCCCAGCCGGGTGGGCACNTGTCCNCCGGTCCGGAAGGN
Sequence Type genomic DNA
Unitrap ID UNI30734 UNI30735

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 43875913..43876286 368
 
EST/CDNA Est Name
  DV075707.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 53127618..53127991 368
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 19145490..19145863 368
 
EST/CDNA Est Name
  BI320042.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 21805351..21805724 368
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101818368..101818741 368
 
EST/CDNA Est Name
  BY559399.1 - BY573808.1 - BY566802.1 - BY484981.1 - CA886748.1 - AI426759.1 - CJ168023.1 - BY302409.1 - AW320348.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 50351849..50352222 368
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 7826454..7826827 368
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 51378414..51378787 368
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 117040063..117040436 368
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 32691479..32691852 368
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 96106985..96107358 368
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 35527968..35528341 368
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 5110451..5110824 368
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 28919793..28920166 368
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 25115150..25115523 368
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 31605983..31606356 368
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 6149160..6149533 368
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068270 (Shroom4) NM_001040459 shroom family member 4 Gene [Source:MGI (curated);Acc:Shroom4-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 16302561..16302934 368
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026748 (Plxdc2) NM_026162 plexin domain containing 2 Gene [Source:MGI (curated);Acc:Plxdc2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 21191162..21191535 368
NO GENE  

 
Come back to gene ENSMUSG00000026748


For any suggestions or comments, please send an email to unitrap@crg.es