Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14373A7
Clone ID IST14373A7
Vector VICTR74
Project tigm

Sequence tag IST14373A7HMF1
Sequence
GGTGGCAGCCCGAATCACACGAGGAACGCAAAGCAGGAGCAACAGGCACACTCCGCAGAGGGGGTACTTAAGACCCTAAC
TTTTCAAGATAGGACCACTTTCACCCACACGTTGCCAGTCCTTTCCTGGCACTTTACAGCGCTCGGGCAGCATATGGGAG
AGAGAACCCCTTTGTCGTTTGGCTGGGTAGCCATCAAAGCTAAGTAAAAACCAGCGTCTGGCTCGGGCCTCCCCGAAGCC
GCAGCGCAGCAGATCAGAACAAGGCCGGGATGACCTCAGCCCCGGGGCTCCACATCCAATGGCCAGCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 66794287..66794593 307
 
EST/CDNA Est Name
  AA066610.1 - BG063163.2 - CO808910.1 - CX734279.1 - AA125177.1 - AI197224.1 - AA420265.1


Sequence tag IST14373A7HMR1
Sequence
CCACCCGTGTACTGTGACTCCAGTAGTAACAATATGTTTCCTTCCACAGCTGGCTAGAGATCTGTTACACCCTTCCTTGG
ANGANGANAANAAAAAACATAAGAAGAAACGGCTGGTTCAGAGCCCAAATTCTTACTTCATGGATGTGAAATGTCCAGGT
ATAAAATTTCAAATTTCCCTGTCCTAAAGGACGTTTCANGAAAGATTCACACTTTAATAAGTCAGGATCCACTGTTC
Sequence Type genomic DNA
Unitrap ID UNI13939

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 66794589..66794824 226
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036781 (Rps27l) NM_026467 ribosomal protein S27-like Gene [Source:MGI Symbol;Acc:MGI:1915191]


Sequence tag IST14373A7BBF1
Sequence
GGTGGCAGCCCGAATCACACGAGGAACGCAAAGCAGGAGCAACAGGCACACTCCGCAGANGGGGTACTTAAGACCCTAAC
TTTTCAAGATAGGACCACTTTCACCCACACGTTGCCAGTCCTTTCCTGGCACTTTACAGCGCTCGGGCAGCATATGGGAG
AGAGAACCCCTTTGTCNTTTGGCTGGGTANCNATCAAAGCTAAGTAAAAACCNGCGTCTGGCTCGGGCCTCCCCGAAGCC
GCAGCGCAGCANANCANNNAAGGCCGGGATGACCTCAGCCCCGGGGCTCCACATCCAATGGCCAGCACANGGCTGCGGCA
TGCTCNCCCGGGGTGGANTGAACGTGTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000036781


For any suggestions or comments, please send an email to unitrap@crg.es