Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11202D1
Clone ID IST11202D1
Vector VICTR76
Project tigm

Sequence tag IST11202D1HMR1
Sequence
CCTTGCCNTCGTCCATGTGACTTTAGTGAGGTTGAAAAAGTGGTACACTGACCTTCAGCCAGACTTGACAGTCTTGGAGA
CAGAAAAATGCCGATCAATCAGAACTCTTTTTATGCCCATGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30920714..30920837 122
NO GENE  


Sequence tag IST11202D1BBF1
Sequence
AAGGCTTCCAACTTGTGGTCTTACCTGAGTGAGGGTCACATGGGCCCTCTGTCGTCCCAGGATGCACTGCAAATGGAACC
TAGAGCTGGGAGGAGACTGCCTGTTATACTATCCACCGTGGTCCAAAGCTTTCCCTCGTTATCCTGTGTGTGTGTGTGTG
TGTGTGTGTGTNTGNGTGTGTGTGTGTN
Sequence Type genomic DNA
Unitrap ID UNI30619

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30920531..30920717 183
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]


Sequence tag IST11202D1HMF1
Sequence
AAGGCTTCCAACTTGTGGTCTTACCTGAGTGAGGGTCACATGGGCCCTCTGTCGTCCCAGGATGCACTGCAAATGGAACC
TANAGCTGGGAGGAGACTGCCTGTTATACTATCCACCGTGGTCCAAAGCTTTCCCTCGTTATCCTGTGTGTGTGTGTGTG
TGTGTGTGTGTGTGTGTGTGTGTGTGTNTN
Sequence Type genomic DNA
Unitrap ID UNI30619

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30920531..30920717 185
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]

 
Come back to gene ENSMUSG00000075415


For any suggestions or comments, please send an email to unitrap@crg.es