Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14529A8
Clone ID IST14529A8
Vector VICTR74
Project tigm

Sequence tag IST14529A8HMR1
Sequence
GTAAATGCTATAAGAGAGTATTAGAAAACAATAATGACTTCAGAGATTAGAATCTACTGCAAAAAAAATTTTTTTTGTGA
CTGAAAACCAGTTGAGGGGAGAGAGAAAAATGTATCANGTCTTGAGAACAAAGACATTCACATGCAGCTTCGGGCAAGGT
TATAACAAGGAATGCATTCATGCCTTTCTTAAGGGATCTTACTGTTTAAAAGTCTTGTGACAGATAATTTCATAAAATAT
TGCATCTTTTCATTGACNNGATGGAATTTANNGTANCCTACAGTAATATTTTANATNAAAGN
Sequence Type genomic DNA
Unitrap ID UNI13524

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 54054297..54054597 285
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006599 (Gtf2h1) NM_008186 general transcription factor II H, polypeptide 1 Gene [Source:MGI (curated);Acc:Gtf2h1-001]


Sequence tag IST14529A8BBF1
Sequence
TTTACCACAACTTGAATTTAATTTTTTAAGCAATTCTCCCTGAGGCAGCATACACAGGACCTTCTCAGGTCTGCACTAGG
TCCTCTGAATATATTATGCCTTCCAGTTTGGTGTTTTTTGGAATTCCCGAGTGTGTGGACGTGTGGGTCTTTGCTTCTCT
CCCTTTGAATGCAGATGATTTAAACTGGGTGTGGTGGCTCAAGCCTGTAATCCCAGCACTTGGGAGGCANAGGCAGGTGC
TACCNANAGTTCAAGGCCAGTTTTTGTTATACTGGAGGACCCCCACCCCTCAAAACAAAATAAAACCTACAAATAGGTTC
AAAATACTTTCCTGAGCTGTTTTCATAAGCCACTGGGCTATCACTAGAGGTTATTTCTGCCTTGTATTTATCTCTTCATG
TGAATACTCTAGTTTTGGTTTTNAANANTCTTAAAGGGTANCTGGGCNTGGTGNCACATGCCTTTNATCNCANCACTCTG
GANTTTNNNGACAGNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 54053808..54054301 462
 
EST/CDNA Est Name
  AA024318.1 - AA014217.1


Sequence tag IST14529A8HMF1
Sequence
TTTACCACAACTTGAATTTAATTTTTTAAGCAATTCTCCCTGAGGCAGCATACACAGGACCTTCTCAGGTCTGCACTAGG
TCCTCTGAATATATTATGCCTTCCAGTTTGGTGTTTTTTGGAATTCCCGAGTGTGTGGACGTGTGGGTCTTTGCTTCTCT
CCCTTTGAATGCAGATGATTTAAACTGGGTGTGGTGGCTCAAGCCTGTAATCCCAGCACTTGGGAGGCAGAGGCAGGTGC
NACCANNAGTTCAAGGCCAGTTTTTGTTATACTGGANGACCCCCACCCCTCAAAACAAAATAAAACCTACAAATAGGTTC
ANAATACTTTCCTGANCTGTTTTCATAAGCCACTGGGCTATCACTAGANGTTATTTCTGCCTTGTANNNNTCTCTTCATG
TGNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 54053900..54054301 380
 
EST/CDNA Est Name
  AA024318.1 - AA014217.1

 
Come back to gene AA024318.1 - AA014217.1


For any suggestions or comments, please send an email to unitrap@crg.es