Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0459
Clone ID GC0459
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0459
Sequence
CTCTCCGAGCTCAGCTCAAGCGGAGCTGTCCGAGCGCCTGCCGCCATCACCACCGCCATCACCCGGCGCTCGCTCAAGCG
CGGAAGAGAGGCCCGGCT
Sequence Type mRNA
Unitrap ID UNI285

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 47896800..47896896 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048379 (Socs4) NM_080843 suppressor of cytokine signaling 6 Gene [Source:MGI (curated);Acc:Socs4-001]

 
Come back to gene ENSMUSG00000048379


For any suggestions or comments, please send an email to unitrap@crg.es