Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14785G7
Clone ID IST14785G7
Vector VICTR76
Project tigm

Sequence tag IST14785G7HMF1
Sequence
NTACAACACAAAGAAGGTGCTCAGCATCTCACCAGCATGAATGCAGGCTGGTGTTCTTTTTCTCACTCTGTATAAATTCT
TTGTTGTGAATGTTGTCACTGACAGACTACTTGTTGTTCCTAAAAGAGCACCACTTTTTACATTCTAGTTCATTTTATGG
TTTTATAAACTAGAAGTTCAGCTTTTCTACAAATCCAAAATTGTGATGTTTGCTAAATATAATCAAACTTAGGGGGGGGG
TANTTTTTTTNAAANAATCACTTGAGGAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 30453559..30453824 260
 
EST/CDNA Est Name
  BB870337.1


Sequence tag IST14785G7BBF1
Sequence
CNACACAAAGAAGGTGNTCAGCATCTCACCAGCATGAATGCAGGCTGGTGTTCTTTTTCTCACTCTGTATAAATTCTTTG
TTGTGAATGTTGTCACTGACAGACTACTTGTTGTTCCTAAAAGAGCACCACTTTTTACATTCTAGTTCATTTTATGGTTT
TATAAACTAGAAGTTCAGCTTTTCTACAAATCCAAAATTGTGATGTTTGCTAAATATAATCAAACTTAGGGGGGGGGTAN
TTTTTTTNAAAAAATCACTTNNNGAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 30453562..30453819 252
 
EST/CDNA Est Name
  BB870337.1


Sequence tag IST14785G7HMR1
Sequence
TCTAGGCTGTGCTTTTTGTGTTTATGCATTTACTTGTATCCTTACAAATCTCCCAGTAAAACAAAAGCAGCAACAGCNNA
NACAGAGCTCATGTTTTCCAGCTCTGATGAACCAAGCACAGGGTGTGTTCATTAACAGATCTTCCTGTACCATTTAACTG
TCACAAAAACAAACCAAAGTTAATTTGTATGTCAAAGACAATGAACCCAAGGCCTANATTTANAAACTTGCCAAAGATGT
ACACCCAAGGAACGAAAGATTATTGGAGCACAAATGATTTTGTACAATGGCTGGCCTCATTCCCTTGCTTTCTCGAACTT
AN
Sequence Type genomic DNA
Unitrap ID UNI14329

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 30453239..30453559 311
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039697 (Ncoa7) NM_172495 nuclear receptor coactivator 7 Gene [Source:MGI Symbol;Acc:MGI:2444847]

 
Come back to gene ENSMUSG00000039697


For any suggestions or comments, please send an email to unitrap@crg.es