Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST467737
Clone ID OST467737
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST467737
Sequence
TTACTGAGCTGGCTGATCCATCATGGCGGNGAAAGTGNNCAACTTNCCACCATTGCCCNNATTCATNCCACTGAANCCAT
GTTNNTACCAAGACTTNGNGGCAGACATNCCTNCTCAGCATCTNANCTTGACCAAGCGCCTCTACTACCTNTGGATGAGA
CAGACAGTTNCTTCAGCTTCATGGNATTCTTCTTCACCTTNATGGNTCAGNTGGCNATCANCATNATNCANGCTGNGGGA
ATTCCANGNTGNGGTGTNTGCGGCTGNGATTGCCACCATTNNCTTNTTNGGNACGAACATCGGNTCAGCAGTGGTGATGC
TCATTCCCACGGNCATGTTCACAGTTGTGGCCGTCTTTTCCTTCATTGCTCTTAGCATGGTTCATAAGTTCTACCGGGGT
AGCGGAGGCAGTTTCAGCAAGGCTCAGGAGGAATGGACCACTGGAGCGTGGAAGAACCCACATGTGCAGCAGGCAGCCCA
GAATGCAGCCATGGGGGCTGCTCAGGGCCAATGC
Sequence Type mRNA
Unitrap ID UNI16024

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57291544..57299815 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040722 (Scamp5) NM_020270 secretory carrier membrane protein 5 Gene [Source:MGI Symbol;Acc:MGI:1928948]

 
Come back to gene ENSMUSG00000040722


For any suggestions or comments, please send an email to unitrap@crg.es