Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13668H10
Clone ID IST13668H10
Vector VICTR74
Project tigm

Sequence tag IST13668H10HMF1
Sequence
GGGGGACAAGTCGCCTTCACTCTGCCCTGGTCCTCCCTGCTGTCTGAATGGTGCTGCCTCCCTTCCCCACATCGTGGGGT
CTGTTTGTCTGTCTTCATCTTTGTTTTTATATATATATATATATANNNNCNCNNGGCCCANTCCCCACCCNTACCCNCAN
TGNNNTNAATTTATCTGTTGTNNAAAANCANCNCCTGCTTCTGCANCATCCCTAATAAAACGTGNNNGCCTCTCCCCNCC
GTGACTGTTGTGTGNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13668H10BBF1
Sequence
GGGGGACAAGTCGCCTTCACTCTGCCCTGGTCCTCCCTGCTGTCTGAATGGTGCTGCCTCCCTTCCCCACATCGTGGGGT
CTGTTTGTCTGTCTTCATCTTTGTTTTT
Sequence Type genomic DNA
Unitrap ID UNI35583

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 99252600..99252707 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023009 (C230021P08Rik) NM_001001884 Riken cDNA C230021P08 gene Gene [Source:MGI Symbol;Acc:MGI:3609653]

 
Come back to gene ENSMUSG00000023009


For any suggestions or comments, please send an email to unitrap@crg.es