Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14530C10
Clone ID IST14530C10
Vector VICTR74
Project tigm

Sequence tag IST14530C10HMF1
Sequence
GCAGTGCTAGGGAGTGAACAAGGGGCCCTGTACACACCAGGGGAGCACCACACCACTGAGAGACATTCCCCCAGCCTGGC
TACTTGATAAAGAAAAAGCAAATAGCCGGGTATGGTAGCGCGCACCTTTAATCCCAGCATTTGGGAGGCAGAGGCAGGCA
GATTTCTGAGTTTGAGGTCAGCCTGGTCTACAAAGTGAGTGCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCAA
AAAACAAACAAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88829035..88829286 244
NO GENE  


Sequence tag IST14530C10HMR1
Sequence
TCCTTAAGATGAAGTCNGAAGAAGGCACCAGAACCCGTACAGTTAGAGTTC
Sequence Type genomic DNA
Unitrap ID UNI3389

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 22369827..22369876 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021767 (Myst4) MYST histone acetyltransferase monocytic leukemia 4 Gene [Source:MGI Symbol;Acc:MGI:1858746]

 
Come back to gene ENSMUSG00000021767


For any suggestions or comments, please send an email to unitrap@crg.es