Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14559H5
Clone ID IST14559H5
Vector VICTR74
Project tigm

Sequence tag IST14559H5HMR1
Sequence
CTACCTTCCCTCCTCAGCCGTCNACAGGATGGGATCACAGGTATGTACCACACCCGACTTTTCAATGCAAAGTTCTTATA
TTTATAATATGAAGATTAGGCCATCTACTTCCCCATAATACTTCTCAAAGTGATTAATATCTAAGTATTATTAATAAAAG
TGTTAAAGATAAAAATGTGAAAATACTCAAAATGGTAAAAAGCTTTCTGTATGATTGGTTTGAATTTTTTATTTTGCATT
TGGTTTGGGGGTTTGGAACCTANACACTCNTGCATGCCAAACACACGCTCCANCNCTATGCCACAAACCCANACCCTGNT
CCNAATATTTGCTTCATTTCCNATTGTANTNANGGAATCAAAAATCTGGGTGAGCNNNGANGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72659360..72659734 347
NO GENE  


Sequence tag IST14559H5HMF1
Sequence
GTAGTGAGTTAGTTTTAGGCCAGTTTGGACTGCATATCAAGACCCTGTTTTAGAAGTGTTTATTTGCTCACTGATCCATC
TCACAGGACCTCACAAACAAACAAAACTCCCCAGATTGAATGTTTAGAGCATCTCTTGCTTTGGTTGGGGACTGTTACAG
GAGAAATTTTGTAGAGTTGCTGTTACGGATTTCAAACAANANGCNCACAAGATATTTAAATTTAGATTTCTCTTTAAAAA
TAAGACAGCTCCCAGTGATCCTGGATTCATAGTTTTGATGTTTAAGAAGCAGCGTCTTGTGACAGGGGCTCTAATCACTC
TTCCTGTGCAGATGTTATCGTGAGCAGGAAGAGATGAGGAGCATTAAGTGGATATTCTGTTGGTGTGTGTGTGTGTGTGT
GTGTGTGTGTGTGTGTGTGTGTGTGTN
Sequence Type genomic DNA
Unitrap ID UNI17261

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72659731..72660156 420
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036030 (Prtg) NM_175485 protogenin homolog (Gallus gallus) Gene [Source:MGI Symbol;Acc:MGI:2444710]

 
Come back to gene ENSMUSG00000036030


For any suggestions or comments, please send an email to unitrap@crg.es