Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST467610
Clone ID OST467610
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST467610
Sequence
TGAGATCCTGAGCAAAATGAAGGGACTCGCACTGGNCACTGAGGCAGAGCTGGAACGCCAGGATGCGGCTCTGGATGGCA
TCACCGTAGCTGTGGACCGGGCAACCCTGAATGTGGACAAGCAAAACCGGCGTATGAGAAAGCTGATGTAGTGGGGCAAG
CTGTAAACAGCCACCCCTGGCATGGCTCTGCTGATTCTATTGCTATTAGCCCTTTTCCTTTCCCCTGAGACCCGGGAAGC
CATTCTGGGTACTGTGAAACTATGAGGCCCTACCTGGGAACTACACCTTCCTAGGATGGGCCAGGAGAGGCCACAATATG
CATGAGCATGTATGTTTCCCGGGGCCCTAAGCATGAGGGCCATGTCCTGTTCAGGCAAGAATCGCCACCGTAGCGTAGCC
ATCCTTCCTGTCCACACTGAGACCCCGGCGTTGAGCTGCCATTGTGGCATCATGTTGTCACATCATATTGTCATCTTTTC
ACCATTTTTGCCAAACAGTAGAGAAAAATGTT
Sequence Type mRNA
Unitrap ID UNI16029

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 59220806..59221314 507
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009894 (1110031B06Rik) NM_144521 RIKEN cDNA 1110031B06 gene Gene [Source:MGI Symbol;Acc:MGI:1915076]

 
Come back to gene ENSMUSG00000009894


For any suggestions or comments, please send an email to unitrap@crg.es