Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14416C2
Clone ID IST14416C2
Vector VICTR74
Project tigm

Sequence tag IST14416C2HMR1
Sequence
NGACAAANNNANAGGAAATNATGATTCTGAGGTCCTCAGTCTAGCATCCCCTGGAAACTTCAGAAATACAGATTCCTAGT
GCTTTAACAGGCCCCCAGCTGAGGCTGGTCCTCACCTAAGTGGGAGAGTGAGGTCACTGTGAGAGCTCACAGGCGGTGTC
TCCAGGCTAGAGTGCTCTCTCCCTCTCCTGCTCTCCAGTCAGGACCATATCCGCACACAGAGTTCTCCGCTTCTGCTTCA
CACTTCCATGCTGGCCCTCTGTCTCTTCATTTGTTCCACTTACTGTTCATTTATTGAGGACCATTTGGTGTCAGGGAGGG
TCCCTAAACGGNNNGTGCTGAGGTGAACAANACNNTGTTGTGCCTTTANGGGCCNTCCNNTCNGGANNTNNTTN
Sequence Type genomic DNA
Unitrap ID UNI31752

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20543711..20544084 350
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049800 (Sertad2) NM_001038625 SERTA domain containing 2 Gene [Source:MGI (curated);Acc:Sertad2-001]


Sequence tag IST14416C2HMF1
Sequence
GTCNGGCNATCTTACACTAAGCCAGANCACACTGTACTCACTGTCTTGACAATGAAGGCCCCCTATTTTTCTGTTTCTAA
GTGAGGAGAGTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20543610..20543701 86
NO GENE  

 
Come back to gene ENSMUSG00000049800


For any suggestions or comments, please send an email to unitrap@crg.es