Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14867E8
Clone ID IST14867E8
Vector VICTR76
Project tigm

Sequence tag IST14867E8BBF1
Sequence
AGCACCATGTGCACACACTGTGGTACATAAAACCACATAGCATCCACCCCCCCACACACAGAGTAAAGATAAATTTTAAA
AAGTCTTTTAAATCCAATTAAGTTCTAAAGGAAGACAGCAATCTTTTAATATACTACTAAGTCAAGTGCACACAGAAAAC
TTTTGAAATGACTGTCTCATCAATGAATAGGGACAGGGAAACATAGACACACACCTACAAAAAAAGCTGGTCAGCANAAT
TAAGACTTTATTTCCAACAGCAATGTCTACTCACTCAAACGTTTGTAAGCAATACTGGTGTGCTAGCATGTGTGAGGTGG
AACATACCATGTTCTTTGTGAGAAAGCCACNNCAGCTGGACCACACACACATCAGTCTCAAGGGAGGGAACAGGGAAAAA
TCACTCACCTGGAATTTGTNNCTTGAGTATAAAAAAGTGCATTTTTATAATANNAACNATTTNATTTAAAAGGAAACAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 9145465..9145940 452
NO GENE  


Sequence tag IST14867E8HMF1
Sequence
AGCACCATGTGCACACACTGTGGTACATAAAACCACATAGCATCCACCCCCCCACACACAGAGTAAAGATAAATTTTAAA
AAGTCTTTTAAATCCAATTAAGTTCTAAAGGAAGACAGCAATCTTTTAATATACTACTAAGTCAAGTGCACACAGAAAAC
TTTTGAAATGACTGTCTCATCAATGAATAGGGACAGGGAAACATAGACACACACCTACAAAAAAAGCTGGTCAGCANAAT
TAANACTTTATTTCCAACAGCAATGTCTACTCACTCAAACGTTTGTAAGCAATACTGGTGTGCTAGCATGTGTGAGGTGG
AACATACCATGTTCTTTGTGAGAAAGCCACAACAGCTGGACCACACACACATCANTCTCAAGGGAGGGAACAGGGAAAAT
CACTCACCTGNAATTTGTANCTTGAGTATAAAANNTGCATTTTTATNATAAAAACAATTTGATTNNAANNGAAACAGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 9145463..9145940 454
NO GENE  


Sequence tag IST14867E8HMR1
Sequence
GTGCTCAGGGTAACTTCTGGAATTTGATTTTTTTTTCCTATGAGTTTTAGGGATGGAACTTGAGTCACTGGGCTTGAGCA
ACTAGCATCTTGACCTGANTGANCCNTTT
Sequence Type genomic DNA
Unitrap ID UNI35590

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 9145936..9146044 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033499 (Larp5) NM_172585 La ribonucleoprotein domain family, member 5 Gene [Source:MGI Symbol;Acc:MGI:106330]

 
Come back to gene ENSMUSG00000033499


For any suggestions or comments, please send an email to unitrap@crg.es