Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12377H8
Clone ID IST12377H8
Vector VICTR76
Project tigm

Sequence tag IST12377H8BBF1
Sequence
ACTTCCGGCTCTCATTACTCTTAGAGGCGAAACAGTTCCTATCTGTCCCTGCGCTTCTCACTCGGGTCCCTTTCCAAGCC
GACCCTGGCCAGAGATCAAGAGAACTTTTTCCCGCGGAAATGGAGGCGGTTCCGGAAGAGGGGCGGGCGCGATGGATTCT
GGGGATTGTAGTCAAAAGCGCGCGGAGGTCCGCGCCGCTCAGGTGACAACACTCCAGCTGGGAGCACCGAGAGGAGAAAG
GCAACACTTACCGAGACTCGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 34752071..34752335 265


Sequence tag IST12377H8HMF1
Sequence
TTGCAGAGGCCACGTAGGGGTGCTGCTTACTGGCTTGCTTC
Sequence Type genomic DNA
Unitrap ID UNI29695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34931788..34931827 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029106 (Add1) NM_013457 adducin 1 (alpha) Gene [Source:MGI (curated);Acc:Add1-002]

 
Come back to gene ENSMUSG00000029106


For any suggestions or comments, please send an email to unitrap@crg.es