Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14971B4
Clone ID IST14971B4
Vector VICTR76
Project tigm

Sequence tag IST14971B4BBF1
Sequence
CTATAGGTTAATACAAATAAGTACTTTTATCAGAGCTACCTCCATGCTAAGATTCCCAAGTACAGATGCTAATAAATACC
ACATGAGCAGGTATCTGAAAACTCTCGATTTCCTACTTCTGATGAGCAGCAGTAGCAGGAGAGGTATAAAAATCATAAGC
CGATAAAGGATTATGCATCTAGTATTACACTCTTAAAAATGTTTAGAGTTGCCGGCACCTTTAATCCCAGCACTTGGGAG
GCAGAGGCAGGCGGATTTCTGAGTTCAAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGTCNNCCNGGGCTACNCANANAA
NCCCTGTCTCGAANAACCAAAAAANANNAANAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 130652800..130653155 332
 
EST/CDNA Est Name
  AV131687.1


Sequence tag IST14971B4HMF1
Sequence
CTATAGGTTAATACAAATAAGTACTTTTATCAGAGCTACCTCCATGCTAAGATTCCCAAGTACAGATGCTAATAAATACC
ACATGAGCAGGTATCTGAAAACTCTCGATTTCCTACTTCTGATGAGCAGCAGTAGCAGGAGAGGTATAAAAATCATAAGC
CGATAAAGGATTATGCATCTAGTATTACACTCTTAAAAATGTTTANAGTTGCCGGCNCCTTTAATCCNANCACTTGGGAG
GCNNANGCNNGNNNATTNNNGNNTTNNANGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 130652914..130653155 234
 
EST/CDNA Est Name
  AV131687.1


Sequence tag IST14971B4HMR1
Sequence
TAGTTAGTAACCTGAAAGGTACTAAGGAGTGATTCTTTATATGGAAACTGTGCTGATCTTGTGTATTTTTATTCTTTTTG
TTAGTTTGAGGTAGGTCTTCACTCTGTAGGTCAGTGTGGCCTTGAACTCACTCTGTAGACCAGGCTGACCTCTGTGATCC
GTCTGCCTCTGCCTCACTGCNATC
Sequence Type genomic DNA
Unitrap ID UNI31250

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 130653153..130653335 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025340 (Rabgef1) NM_019983 RAB guanine nucleotide exchange factor (GEF) 1 Gene [Source:MGI (curated);Acc:Rabgef1-001]

 
Come back to gene ENSMUSG00000025340


For any suggestions or comments, please send an email to unitrap@crg.es