Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12373H12
Clone ID IST12373H12
Vector VICTR76
Project tigm

Sequence tag IST12373H12HMF1
Sequence
TTAGCAACCACATGGTGGCTCACAACCATCCGTAACGAGATCTGACTCCCTCTTCTGGAGTCTAGTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 51631920..51631985 66
NO GENE  


Sequence tag IST12373H12BBF1
Sequence
TTAGCAACCACATGGTGGCTCACAACCATCCGTAACGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI22766 UNI31785 UNI35592

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 34795571..34795613 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024370 (Cdc23) NM_178347 CDC23 (cell division cycle 23, yeast, homolog) Gene [Source:MGI Symbol;Acc:MGI:1098815]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 95212924..95212966 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 89179407..89179449 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 86333969..86334011 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 101337905..101337947 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 78149465..78149507 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108064358..108064400 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013160 (Atp6v0d1) NM_013477 ATPase, H+ transporting, lysosomal V0 subunit D1 Gene [Source:MGI (curated);Acc:Atp6v0d1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 51631943..51631985 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 139062423..139062465 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047940 (B930007M17Rik) NM_198659 RIKEN cDNA B930007M17 gene Gene [Source:MGI Symbol;Acc:MGI:2685863]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 65195493..65195535 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 89334667..89334709 43
NO GENE  

 
Come back to gene ENSMUSG00000047940


For any suggestions or comments, please send an email to unitrap@crg.es