Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14331A1
Clone ID IST14331A1
Vector VICTR74
Project tigm

Sequence tag IST14331A1HMR1
Sequence
ATAGGTGTTGGGCTATGTCTTGTCCTACACCTACTTACACACATACTGGCAATGGTTATCTTCAGGTTTGACTCATTTGA
ACTTANCANTGGGAACATCTCTATAGGGGGAAAAAAAAACCGANCCNATTGCCCTGTGACCTCCTTTGAAAAAAAATTAC
NCNCTCACCANAATCNAGAAGGCGTACNCNCNCTGATATGTTGCCATANCTACCATAGGGCCACTCTTCTCCCAAGTCCA
TGACCTCAAAAGTGCCNCGGAGGGAATTTCTGCAGGGAATGCCTTCCCTTANGCTGACTGCCGGCCCAGGGTGCATCTNN
AACCCANGANGGCTGANGTGAANACTGNANGGANCATCCTTAAAANCTATCTTACCANCCNTCACTCCGTGCACATGGGA
AANCCTGCTNNNTCAAANCCCTGTGATTCCTATAGTNTGANCTTGTTATGGNTTCTCNNGATGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14331A1HMF1
Sequence
CCATCACCTGTTTGTATGTTTTTTCCTCTTTTTCTGTAAGGACTTCTACCTGTTTGATTGTGTTTTCCTGTTTTTCTTTA
AGGACTTGTAACTCTTTAGCAGTGTTCTCCTGTATTTCTTTAAGTGATTTATTAAAGTCCTTCTTGATGCCCTCTACCAT
CATCATGANATATGCTTTTAAATCTAGGTCTAGGTTCTCAGGTGTGTTGGGGTTCCCTGGACTGGGCGAAGTGGGTGTGC
TGGGTTCTGGTGATGGTGANTGGTCTTGGTTCCNGTTANTAANATTCCTCCGTTTACCTTTCGCNNTCTGGTAATCTCTG
GAGTTANTANTTATANTTCNNNCC
Sequence Type genomic DNA
Unitrap ID UNI4014 UNI32291

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4621529..4621866 318
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 33102167..33102504 318
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35520808..35521145 318
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041408 (Wapal) NM_001004436 wings apart-like homolog (Drosophila) Gene [Source:MGI (curated);Acc:Wapal-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 73295803..73296140 318
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 62340720..62341057 318
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063297 (Luzp2) NM_178705 leucine zipper protein 2 Gene [Source:MGI Symbol;Acc:MGI:1889615]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 29504203..29504540 318
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 51666508..51666845 318
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52990810..52991147 318
 
EST/CDNA Est Name
  AA023656.1 - AI508299.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 138260701..138261038 318
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 100263942..100264279 318
NO GENE  

 
Come back to gene AA023656.1 - AI508299.1


For any suggestions or comments, please send an email to unitrap@crg.es